1. Introduction
This experiment was designed to evaluate the performance of our 1000 Å Co-Polymer Coated CPG in the practical synthesis of medium-length oligonucleotides, with a specific focus on RNA synthesis. Notably, this evaluation was conducted under our high-loading condition of 105 µmol/g, whereas traditional modified CPG of the same pore size typically exhibits a low loading capacity of less than 50 µmol/g. To rigorously test our support under these demanding conditions, we selected a 60-nt fully 2′-O-Methyl (2′-OMe) modified RNA sequence as a benchmark case to demonstrate its real-world synthetic capability and efficiency.
2. Research Overview
| Item | Specification |
|---|---|
| Solid Support | 1000 Å co-polymer coated CPG with Unylinker |
| CPG Loading Capacity | 105 µmol/g |
| RNA Length | 60 nt |
| RNA Chemical Type | 2′-OMe Modified RNA |
| RNA Sequence (5’→3′) | UGCCUGGCGGCAGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAAC |
| Base Composition | A: 12, U: 9, G: 18, C: 21 |
| Monomer Consumption | 2′-OMe-rA(Bz): 12, 2′-OMe-rC(Ac): 21, 2′-OMe-rG(ibu): 18, 2′-OMe-rU: 9 |
| Sample Name | LWC20260827RNA1000A60NT23 |
| Sample Type | Oligonucleotide RNA |
| HPLC Detection | 260 nm |
| Injection Volume | 10.00 µL |
| HPLC Run Time | 30 min |
3. HPLC Analysis & Purity Results
Full-Length Product (FLP) Purity Assessment:
Crude FLP Purity (Unpurified): 92.95% (Retention Time: 27.561 min)
Complete Chromatographic Peaks Summary
(Detection Channel: 2998 Ch1 260nm @ 1.2nm)
| Peak # | Retention Time (min) | Peak Area ($\mu V \cdot sec$) | Area Percentage (%) | Peak Height ($\mu V$) |
|---|---|---|---|---|
| 1 | 1.739 | 41,645 | 0.28% | 4,699 |
| 2 | 2.180 | 73,441 | 0.50% | 14,266 |
| 3 | 3.083 | 4,322 | 0.03% | 741 |
| 4 | 8.058 | 16,034 | 0.11% | 1,382 |
| 5 | 8.655 | 45,967 | 0.31% | 3,187 |
| 6 | 11.585 | 23,480 | 0.16% | 2,151 |
| 7 | 18.920 | 83,366 | 0.57% | 7,994 |
| 8 | 21.276 | 6,145 | 0.04% | 648 |
| 9 | 22.721 | 2,472 | 0.02% | 359 |
| 10 | 23.225 | 3,093 | 0.02% | 475 |
| 11 | 23.510 | 2,557 | 0.02% | 380 |
| 12 | 23.659 | 2,953 | 0.02% | 407 |
| 13 | 23.912 | 10,351 | 0.07% | 1,138 |
| 14 | 24.732 | 2,654 | 0.02% | 302 |
| 15 | 25.099 | 13,345 | 0.09% | 1,209 |
| 16 | 25.521 | 11,109 | 0.08% | 1,259 |
| 17 | 25.825 | 35,158 | 0.24% | 3,379 |
| 18 | 26.056 | 10,768 | 0.07% | 1,436 |
| 19 | 26.787 | 238,012 | 1.62% | 9,894 |
| 20 | 27.105 | 188,080 | 1.28% | 11,798 |
| 21 (FLP) | 27.561 | 13,627,422 | 92.95% | 2,139,643 |
| 22 | 28.235 | 9,908 | 0.07% | 7,951 |
| 23 | 28.334 | 121,084 | 0.83% | 11,899 |
| 24 | 28.502 | 66,337 | 0.45% | 5,068 |
| 25 | 28.915 | 21,111 | 0.14% | 2,466 |
4. Conclusion & Value Proposition
In summary, the results conclusively demonstrate that PoresynSolutions‘ solid support exhibits outstanding performance in synthesizing 60-nt RNA, achieving exceptionally high unpurified crude purity even under the high loading capacity premise of 105 µmol/g. It is readily evident from this case that under identical synthetic environments, utilizing Poresyn Solutions’ 1000A Co-Polymer CPG for medium-length (50–75 nt) DNA or RNA sequences consistently delivers superior yields and significantly enhanced actual oligonucleotide FLP purity. For biopharmaceutical companies, this technological advantage translates into substantial savings in equipment, labor, and time costs, while dramatically reducing downstream purification expenses.