Introduction
120 nt RNA is considered a long-chain RNA product, and the development of RNA therapeutics is driving increasing demand for longer and more highly modified RNA sequences.
Long-chain RNA synthesis becomes increasingly challenging when bulky protecting groups such as TBDMS are introduced. The steric demand of TBDMS chemistry can negatively affect coupling efficiency and overall synthesis performance, resulting in lower crude purity and making large-scale manufacturing more challenging. In addition, conventional CPG supports typically offer relatively low loading capacity, which can further limit the overall productivity of long-chain RNA synthesis.
To address these challenges, this study evaluated our 2000 Å Co-Polymer Coated CPG with Unylinker (N-Ph) at a loading capacity of 55 μmol/g for the synthesis of 120 nt TBDMS-protected RNA. Three independent synthesis runs were performed to evaluate crude purity, synthesis consistency, and overall performance under high-loading conditions.
The experimental results are presented below.
1. Study Overview
| Item | Specification |
|---|---|
| Solid Support | 2000 Å Co-Polymer Coated CPG with Unylinker (N-Ph) |
| CPG Loading Capacity | 55 μmol/g |
| RNA Length | 120 nt |
| RNA Chemistry | TBDMS-protected RNA |
| RNA Sequence (5′→3′) | UGCCUGGCGGCAGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU |
| Base Composition | A: 24 · U: 20 · G: 41 · C: 35 |
| Independent Syntheses | 3 |
| CPG Loading Basis | 55 μmol/g |
| HPLC Detection | 260 nm |
| Injection Volume | 10.00 μL |
| HPLC Run Time | 30 min |
Three independent synthesis experiments were performed using the same Co-Polymer Coated CPG product. For all experiments, the material input was calculated and charged according to a CPG loading capacity of 55 μmol/g.
2. HPLC Results — Three Independent Experiments
| HPLC Parameter | Sample 1 | Sample 2 | Sample 3 |
|---|---|---|---|
| Main Peak RT (min) | 27.597 | 27.534 | 27.578 |
| Main Peak Area (μV·s) | 13,094,656 | 5,715,618 | 9,508,879 |
| Main Peak Area (%) | 94.22% | 93.83% | 95.97% |
| Other Peak 1 (%) | 1.33% | 1.55% | 1.87% |
| Other Peak 2 (%) | 1.07% | 2.72% | 2.16% |
| Other Peak 3 (%) | 0.97% | 1.89% | — |
| Other Peak 4 (%) | 1.20% | — | — |
| Other Peak 5 (%) | 1.20% | — | — |
HPLC main product peak: the predominant peak observed in each chromatogram was used for the reported area percentage.
Detailed Report for Sample 1:
Detailed Report for sample 2:
Detailed Report for sample 3:
Conclusion
Consistently High Crude Purity in Long-Chain RNA Synthesis
Under a standardized CPG loading capacity of 55 μmol/g, three independent syntheses of 120 nt TBDMS-protected RNA using 2000ACo-Polymer Coated CPG produced crude products with HPLC area purities of:
94.22% / 93.83% / 95.97%; The average crude product purity was 94.67%.
High Synthesis Performance with TBDMS Chemistry
Despite the relatively large steric demand of TBDMS protecting groups, the high loading level did not result in a significant loss of crude purity. These results demonstrate that the Co-Polymer Coated CPG can achieve high loading, high crude purity, and good synthesis reproducibility, making it well suited for long-chain RNA synthesis.